Review




Structured Review

GenScript corporation znf277 crispr grna plasmids
( A ) In human small intestine (SI) and colonic crypts, <t>ZNF277</t> is expressed selectively in the nuclei of transit amplifying cells (TACs). In the human ileum, IHC staining reveals ZNF277 and Ki67 expression in TACs. IHC reveals ZNF277 and Ki67 expression in transverse colon TACs. ( B ) Murine small intestinal and colonic TACs coexpress Zfp277 and Ki67. Immunofluorescence (IF) staining reveals Zfp277 and Ki67 expression in mouse ileal TACs and DAPI nuclear stains of mouse ileum. Merged Zfp277, Ki67, and DAPI confocal images reveal colocalization of Zfp277 and Ki67. IF staining reveals Zfp277 and Ki67 expression in murine colonic TACs. Merged Zfp277, Ki67, and DAPI images reveal Zfp277 and Ki67colocalization. ( C ) Nuclear localization of ZNF277/Zfp277 by IHC and IF staining. IHC reveals nuclear Zfp277 expression in a colon adenoma from an Apc Min/+ mouse. IF staining reveals nuclear ZNF277 expression in HT29 human colon cancer cells. DAPI staining of HT29 cell nuclei. IHC reveals nuclear ZNF277 expression of cells in an HT29 cell xenograft, nuclear ZNF277 expression in human colon cancer and adjacent normal colon (arrow). Higher-magnification image showing nuclear ZNF277 expression in human colon cancer. Size bars: 100 μM.
Znf277 Crispr Grna Plasmids, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/znf277 crispr grna plasmids/product/GenScript corporation
Average 90 stars, based on 1 article reviews
znf277 crispr grna plasmids - by Bioz Stars, 2026-06
90/100 stars

Images

1) Product Images from "Zinc finger protein 277 is an intestinal transit-amplifying cell marker and colon cancer oncogene"

Article Title: Zinc finger protein 277 is an intestinal transit-amplifying cell marker and colon cancer oncogene

Journal: JCI Insight

doi: 10.1172/jci.insight.150894

( A ) In human small intestine (SI) and colonic crypts, ZNF277 is expressed selectively in the nuclei of transit amplifying cells (TACs). In the human ileum, IHC staining reveals ZNF277 and Ki67 expression in TACs. IHC reveals ZNF277 and Ki67 expression in transverse colon TACs. ( B ) Murine small intestinal and colonic TACs coexpress Zfp277 and Ki67. Immunofluorescence (IF) staining reveals Zfp277 and Ki67 expression in mouse ileal TACs and DAPI nuclear stains of mouse ileum. Merged Zfp277, Ki67, and DAPI confocal images reveal colocalization of Zfp277 and Ki67. IF staining reveals Zfp277 and Ki67 expression in murine colonic TACs. Merged Zfp277, Ki67, and DAPI images reveal Zfp277 and Ki67colocalization. ( C ) Nuclear localization of ZNF277/Zfp277 by IHC and IF staining. IHC reveals nuclear Zfp277 expression in a colon adenoma from an Apc Min/+ mouse. IF staining reveals nuclear ZNF277 expression in HT29 human colon cancer cells. DAPI staining of HT29 cell nuclei. IHC reveals nuclear ZNF277 expression of cells in an HT29 cell xenograft, nuclear ZNF277 expression in human colon cancer and adjacent normal colon (arrow). Higher-magnification image showing nuclear ZNF277 expression in human colon cancer. Size bars: 100 μM.
Figure Legend Snippet: ( A ) In human small intestine (SI) and colonic crypts, ZNF277 is expressed selectively in the nuclei of transit amplifying cells (TACs). In the human ileum, IHC staining reveals ZNF277 and Ki67 expression in TACs. IHC reveals ZNF277 and Ki67 expression in transverse colon TACs. ( B ) Murine small intestinal and colonic TACs coexpress Zfp277 and Ki67. Immunofluorescence (IF) staining reveals Zfp277 and Ki67 expression in mouse ileal TACs and DAPI nuclear stains of mouse ileum. Merged Zfp277, Ki67, and DAPI confocal images reveal colocalization of Zfp277 and Ki67. IF staining reveals Zfp277 and Ki67 expression in murine colonic TACs. Merged Zfp277, Ki67, and DAPI images reveal Zfp277 and Ki67colocalization. ( C ) Nuclear localization of ZNF277/Zfp277 by IHC and IF staining. IHC reveals nuclear Zfp277 expression in a colon adenoma from an Apc Min/+ mouse. IF staining reveals nuclear ZNF277 expression in HT29 human colon cancer cells. DAPI staining of HT29 cell nuclei. IHC reveals nuclear ZNF277 expression of cells in an HT29 cell xenograft, nuclear ZNF277 expression in human colon cancer and adjacent normal colon (arrow). Higher-magnification image showing nuclear ZNF277 expression in human colon cancer. Size bars: 100 μM.

Techniques Used: Immunohistochemistry, Expressing, Immunofluorescence, Staining

( A ) ZNF277 RNA interference reduces ZNF277 protein expression in human colon cancer cells. Immunoblots of extracts from HT29, H508, and SNUC4 human colon cancer cells after ZNF277 knockdown with the indicated concentrations of ZNF277 siRNA and 50 nM mock siRNA. ( B ) ZNF277 deficiency attenuates human colon cancer cell proliferation. Cells were transfected for 24 hours with siRNA, and cell proliferation was measured after an additional 24-hour incubation. * P < 0.05 versus control siRNA. Data represent mean ± SEM from 3 separate experiments. ( C ) Immunoblotting confirms ZNF277 overexpression in HT29 cells transfected with plasmid containing full-length human ZNF277 cDNA. ( D ) Overexpressing ZNF277 stimulates HT29 cell proliferation. * P < 0.05 versus control cells. Data represent mean ± SEM from 3 separate experiments. ( E ) Immunoblots reveal lack of ZNF277 expression in 4 HEK293 lines following CRISPR KO of ZNF277 . ( F ) CRISPR KO of ZNF277 attenuates HEK293 cell proliferation. * P < 0.05 versus control cells. ** P < 0.05 versus line 1-2. Data are shown as mean ± SD from 7 separate experiments. Data were analyzed using 2-tailed t tests and 1-way ANOVA with post hoc Tukey test. β-Actin and lamin B1 were used as loading controls in A and C , respectively.
Figure Legend Snippet: ( A ) ZNF277 RNA interference reduces ZNF277 protein expression in human colon cancer cells. Immunoblots of extracts from HT29, H508, and SNUC4 human colon cancer cells after ZNF277 knockdown with the indicated concentrations of ZNF277 siRNA and 50 nM mock siRNA. ( B ) ZNF277 deficiency attenuates human colon cancer cell proliferation. Cells were transfected for 24 hours with siRNA, and cell proliferation was measured after an additional 24-hour incubation. * P < 0.05 versus control siRNA. Data represent mean ± SEM from 3 separate experiments. ( C ) Immunoblotting confirms ZNF277 overexpression in HT29 cells transfected with plasmid containing full-length human ZNF277 cDNA. ( D ) Overexpressing ZNF277 stimulates HT29 cell proliferation. * P < 0.05 versus control cells. Data represent mean ± SEM from 3 separate experiments. ( E ) Immunoblots reveal lack of ZNF277 expression in 4 HEK293 lines following CRISPR KO of ZNF277 . ( F ) CRISPR KO of ZNF277 attenuates HEK293 cell proliferation. * P < 0.05 versus control cells. ** P < 0.05 versus line 1-2. Data are shown as mean ± SD from 7 separate experiments. Data were analyzed using 2-tailed t tests and 1-way ANOVA with post hoc Tukey test. β-Actin and lamin B1 were used as loading controls in A and C , respectively.

Techniques Used: Expressing, Western Blot, Knockdown, Transfection, Incubation, Control, Over Expression, Plasmid Preparation, CRISPR

( A ) Immunoblots of HT29 cell extracts without (control) or with CRISPR knockdown of ZNF277 expression. β-Actin was used as a loading control. ( B ) ZNF277 deficiency attenuates HT29 cell proliferation in vitro from 7 separate experiments. ( C ) ZNF277 deficiency attenuates xenograft growth. Time-course reveals reduced volume of ZNF277 CRISPR HT29 cell–derived xenografts ( n = 8) compared with control xenografts ( n = 7). ( D ) Representative images of s.c. and excised xenografts from HT29 ZNF277 CRISPR versus control cells. Arrows and arrowheads indicate control and HT29 ZNF277 CRISPR xenografts, respectively. ( E ) Reduced weights of xenografts with ZNF277 deficiency ( n = 8). * P < 0.01 versus controls ( n = 7); 2-tailed Student’s t test. ( F ) Representative microscopic images of control and ZNF277 -deficient xenografts stained for H&E, p21 WAF1 , and p53. ( G ) ZNF277, p21 WAF1 , p53, and β-catenin immunoblots of proteins extracted from ZNF277 CRISPR cell– and control cell–derived tumors (2 separate tumors from each group). Values represent mean ± SD. Scale bar: 100 μM.
Figure Legend Snippet: ( A ) Immunoblots of HT29 cell extracts without (control) or with CRISPR knockdown of ZNF277 expression. β-Actin was used as a loading control. ( B ) ZNF277 deficiency attenuates HT29 cell proliferation in vitro from 7 separate experiments. ( C ) ZNF277 deficiency attenuates xenograft growth. Time-course reveals reduced volume of ZNF277 CRISPR HT29 cell–derived xenografts ( n = 8) compared with control xenografts ( n = 7). ( D ) Representative images of s.c. and excised xenografts from HT29 ZNF277 CRISPR versus control cells. Arrows and arrowheads indicate control and HT29 ZNF277 CRISPR xenografts, respectively. ( E ) Reduced weights of xenografts with ZNF277 deficiency ( n = 8). * P < 0.01 versus controls ( n = 7); 2-tailed Student’s t test. ( F ) Representative microscopic images of control and ZNF277 -deficient xenografts stained for H&E, p21 WAF1 , and p53. ( G ) ZNF277, p21 WAF1 , p53, and β-catenin immunoblots of proteins extracted from ZNF277 CRISPR cell– and control cell–derived tumors (2 separate tumors from each group). Values represent mean ± SD. Scale bar: 100 μM.

Techniques Used: Western Blot, Control, CRISPR, Knockdown, Expressing, In Vitro, Derivative Assay, Staining

( A ) β-Catenin ( CTNNB1 ) knockdown decreases ZNF277 levels in human HT29, H508, and SNUC4 colon cancer cells. ( B ) ZNF277 knockdown does not alter β-catenin levels in HT29 and H508 colon cancer cells. Maximum siRNA concentration was 50 μM. ( C ) Increased β-catenin signaling augments Zfp277 expression. Zfp277 expression in colon mucosal extracts from WT, Apc Min/+ , and Zfp277 –/– mice. β-Actin was used as a loading control. ( D ) ZNF277 promoter elements for β-catenin. ChIP assay using random DNA fragments generated by MNase digestion in HT29 cells. ZNF277 promoter positions are indicated in the text and DNA sequences of qPCR primers are listed in . Data are shown as mean ± SEM from 3 separate experiments. ( E ) ZNF277 coimmunoprecipitates with BMI1 in SNUC4 colon cancer cells. Rabbit immunoglobulins (IgG) were used as control.
Figure Legend Snippet: ( A ) β-Catenin ( CTNNB1 ) knockdown decreases ZNF277 levels in human HT29, H508, and SNUC4 colon cancer cells. ( B ) ZNF277 knockdown does not alter β-catenin levels in HT29 and H508 colon cancer cells. Maximum siRNA concentration was 50 μM. ( C ) Increased β-catenin signaling augments Zfp277 expression. Zfp277 expression in colon mucosal extracts from WT, Apc Min/+ , and Zfp277 –/– mice. β-Actin was used as a loading control. ( D ) ZNF277 promoter elements for β-catenin. ChIP assay using random DNA fragments generated by MNase digestion in HT29 cells. ZNF277 promoter positions are indicated in the text and DNA sequences of qPCR primers are listed in . Data are shown as mean ± SEM from 3 separate experiments. ( E ) ZNF277 coimmunoprecipitates with BMI1 in SNUC4 colon cancer cells. Rabbit immunoglobulins (IgG) were used as control.

Techniques Used: Knockdown, Concentration Assay, Expressing, Control, Generated

( A ) siRNA and CRISPR knockdown of ZNF277 expression augments p21 WAF1 levels in HT29, H508, and HEK293 cells. β-Actin was used as a loading control. ( B ) Levels of murine p21 WAF1 expression are augmented in colon tissue extracts from Apc Min/+ and Zfp277 –/– mice. Experiments were performed using tissues from 2 separate 8-week-old mice of each genotype. ( C ) Upregulated p21 WAF1 expression after p53 and ZNF277 knockdown in HT29 cells. All siRNAs were 25 nM, except lane 4 (50 nM). ( D ) ZNF277 knockdown augments p21 WAF1 mRNA levels in HT29 cells. Data are shown as mean ± SEM from 3 separate experiments. * P < 0.01 (2-tailed Student’s t test). ( E ) Zfp277 deficiency stimulates cellular senescence. β-Galactosidase staining in control HT29 cells ( A ) and HT29 cells with CRISPR knockdown of ZNF277 ( B ). Scale bar: 50 μM. ( F ) Zfp277 deficiency increases p21 WAF1 expression. IHC of p21 WAF1 in the normal small intestine of WT ( A ) and Zfp277 –/– ( B ) mice, as well as in small intestine adenomas from Zfp277 +/+ Apc Min/+ ( C ) and Zfp277 –/– Apc Min/+ ( D ) mice. Arrows indicate adenomas. Scale bar: 100 μM.
Figure Legend Snippet: ( A ) siRNA and CRISPR knockdown of ZNF277 expression augments p21 WAF1 levels in HT29, H508, and HEK293 cells. β-Actin was used as a loading control. ( B ) Levels of murine p21 WAF1 expression are augmented in colon tissue extracts from Apc Min/+ and Zfp277 –/– mice. Experiments were performed using tissues from 2 separate 8-week-old mice of each genotype. ( C ) Upregulated p21 WAF1 expression after p53 and ZNF277 knockdown in HT29 cells. All siRNAs were 25 nM, except lane 4 (50 nM). ( D ) ZNF277 knockdown augments p21 WAF1 mRNA levels in HT29 cells. Data are shown as mean ± SEM from 3 separate experiments. * P < 0.01 (2-tailed Student’s t test). ( E ) Zfp277 deficiency stimulates cellular senescence. β-Galactosidase staining in control HT29 cells ( A ) and HT29 cells with CRISPR knockdown of ZNF277 ( B ). Scale bar: 50 μM. ( F ) Zfp277 deficiency increases p21 WAF1 expression. IHC of p21 WAF1 in the normal small intestine of WT ( A ) and Zfp277 –/– ( B ) mice, as well as in small intestine adenomas from Zfp277 +/+ Apc Min/+ ( C ) and Zfp277 –/– Apc Min/+ ( D ) mice. Arrows indicate adenomas. Scale bar: 100 μM.

Techniques Used: CRISPR, Knockdown, Expressing, Control, Staining

Posterior Hoxd genes are Zfp277 transcriptional targets. ( A ) Heatmap of differentially expressed genes in colon mucosa from 3 WT mice and 3 Zfp277 –/– littermates. ( B ) Top 16 upregulated genes from RNA-Seq, excluding immunoglobulins. Genes in the Hoxd cluster are highlighted in red. ( C ) Schematic of the murine Hoxd posterior gene clusters. ( D ) qPCR of Hoxd13 mRNA expression in colon mucosal tissue from WT and Zfp277 –/– mice. Values represent mean ± SEM ( n = 3 each). ( E ) ZNF277 represses HOXD13 gene expression. HOXD13 immunoblot of proteins extracted from ZNF277 CRISPR cell- and control cell–derived xenograft tumors (2 separate tumors from each group). ( F ) Model illustrating the role of ZNF 2 77/Zfp277 in intestinal tumorigenesis. ZNF277 , normally expressed in TACs but not in differentiated enterocytes, maintains intestinal homeostasis. Aberrant WNT signaling stimulates ZNF277 overexpression in TACs. ZNF277 interacts with BMI1 in the PRC1 complex and represses p21 WAF1 expression, thereby stimulating cell proliferation and attenuating cell senescence, as well as enhancing tumorigenesis and progressive neoplasia.
Figure Legend Snippet: Posterior Hoxd genes are Zfp277 transcriptional targets. ( A ) Heatmap of differentially expressed genes in colon mucosa from 3 WT mice and 3 Zfp277 –/– littermates. ( B ) Top 16 upregulated genes from RNA-Seq, excluding immunoglobulins. Genes in the Hoxd cluster are highlighted in red. ( C ) Schematic of the murine Hoxd posterior gene clusters. ( D ) qPCR of Hoxd13 mRNA expression in colon mucosal tissue from WT and Zfp277 –/– mice. Values represent mean ± SEM ( n = 3 each). ( E ) ZNF277 represses HOXD13 gene expression. HOXD13 immunoblot of proteins extracted from ZNF277 CRISPR cell- and control cell–derived xenograft tumors (2 separate tumors from each group). ( F ) Model illustrating the role of ZNF 2 77/Zfp277 in intestinal tumorigenesis. ZNF277 , normally expressed in TACs but not in differentiated enterocytes, maintains intestinal homeostasis. Aberrant WNT signaling stimulates ZNF277 overexpression in TACs. ZNF277 interacts with BMI1 in the PRC1 complex and represses p21 WAF1 expression, thereby stimulating cell proliferation and attenuating cell senescence, as well as enhancing tumorigenesis and progressive neoplasia.

Techniques Used: RNA Sequencing, Expressing, Gene Expression, Western Blot, CRISPR, Control, Derivative Assay, Over Expression



Similar Products

90
GenScript corporation znf277 crispr grna plasmids
( A ) In human small intestine (SI) and colonic crypts, <t>ZNF277</t> is expressed selectively in the nuclei of transit amplifying cells (TACs). In the human ileum, IHC staining reveals ZNF277 and Ki67 expression in TACs. IHC reveals ZNF277 and Ki67 expression in transverse colon TACs. ( B ) Murine small intestinal and colonic TACs coexpress Zfp277 and Ki67. Immunofluorescence (IF) staining reveals Zfp277 and Ki67 expression in mouse ileal TACs and DAPI nuclear stains of mouse ileum. Merged Zfp277, Ki67, and DAPI confocal images reveal colocalization of Zfp277 and Ki67. IF staining reveals Zfp277 and Ki67 expression in murine colonic TACs. Merged Zfp277, Ki67, and DAPI images reveal Zfp277 and Ki67colocalization. ( C ) Nuclear localization of ZNF277/Zfp277 by IHC and IF staining. IHC reveals nuclear Zfp277 expression in a colon adenoma from an Apc Min/+ mouse. IF staining reveals nuclear ZNF277 expression in HT29 human colon cancer cells. DAPI staining of HT29 cell nuclei. IHC reveals nuclear ZNF277 expression of cells in an HT29 cell xenograft, nuclear ZNF277 expression in human colon cancer and adjacent normal colon (arrow). Higher-magnification image showing nuclear ZNF277 expression in human colon cancer. Size bars: 100 μM.
Znf277 Crispr Grna Plasmids, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/znf277 crispr grna plasmids/product/GenScript corporation
Average 90 stars, based on 1 article reviews
znf277 crispr grna plasmids - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

Image Search Results


( A ) In human small intestine (SI) and colonic crypts, ZNF277 is expressed selectively in the nuclei of transit amplifying cells (TACs). In the human ileum, IHC staining reveals ZNF277 and Ki67 expression in TACs. IHC reveals ZNF277 and Ki67 expression in transverse colon TACs. ( B ) Murine small intestinal and colonic TACs coexpress Zfp277 and Ki67. Immunofluorescence (IF) staining reveals Zfp277 and Ki67 expression in mouse ileal TACs and DAPI nuclear stains of mouse ileum. Merged Zfp277, Ki67, and DAPI confocal images reveal colocalization of Zfp277 and Ki67. IF staining reveals Zfp277 and Ki67 expression in murine colonic TACs. Merged Zfp277, Ki67, and DAPI images reveal Zfp277 and Ki67colocalization. ( C ) Nuclear localization of ZNF277/Zfp277 by IHC and IF staining. IHC reveals nuclear Zfp277 expression in a colon adenoma from an Apc Min/+ mouse. IF staining reveals nuclear ZNF277 expression in HT29 human colon cancer cells. DAPI staining of HT29 cell nuclei. IHC reveals nuclear ZNF277 expression of cells in an HT29 cell xenograft, nuclear ZNF277 expression in human colon cancer and adjacent normal colon (arrow). Higher-magnification image showing nuclear ZNF277 expression in human colon cancer. Size bars: 100 μM.

Journal: JCI Insight

Article Title: Zinc finger protein 277 is an intestinal transit-amplifying cell marker and colon cancer oncogene

doi: 10.1172/jci.insight.150894

Figure Lengend Snippet: ( A ) In human small intestine (SI) and colonic crypts, ZNF277 is expressed selectively in the nuclei of transit amplifying cells (TACs). In the human ileum, IHC staining reveals ZNF277 and Ki67 expression in TACs. IHC reveals ZNF277 and Ki67 expression in transverse colon TACs. ( B ) Murine small intestinal and colonic TACs coexpress Zfp277 and Ki67. Immunofluorescence (IF) staining reveals Zfp277 and Ki67 expression in mouse ileal TACs and DAPI nuclear stains of mouse ileum. Merged Zfp277, Ki67, and DAPI confocal images reveal colocalization of Zfp277 and Ki67. IF staining reveals Zfp277 and Ki67 expression in murine colonic TACs. Merged Zfp277, Ki67, and DAPI images reveal Zfp277 and Ki67colocalization. ( C ) Nuclear localization of ZNF277/Zfp277 by IHC and IF staining. IHC reveals nuclear Zfp277 expression in a colon adenoma from an Apc Min/+ mouse. IF staining reveals nuclear ZNF277 expression in HT29 human colon cancer cells. DAPI staining of HT29 cell nuclei. IHC reveals nuclear ZNF277 expression of cells in an HT29 cell xenograft, nuclear ZNF277 expression in human colon cancer and adjacent normal colon (arrow). Higher-magnification image showing nuclear ZNF277 expression in human colon cancer. Size bars: 100 μM.

Article Snippet: We purchased 2 ZNF277 CRISPR gRNA plasmids (project name U4370DK190-1; clone C93266, gRNA TTGCAGTTTACAATGTTGTC; project name U4370DK190-2, clone C93269, gRNA AGACAGTAAGCATTGTATCC) from GenScript.

Techniques: Immunohistochemistry, Expressing, Immunofluorescence, Staining

( A ) ZNF277 RNA interference reduces ZNF277 protein expression in human colon cancer cells. Immunoblots of extracts from HT29, H508, and SNUC4 human colon cancer cells after ZNF277 knockdown with the indicated concentrations of ZNF277 siRNA and 50 nM mock siRNA. ( B ) ZNF277 deficiency attenuates human colon cancer cell proliferation. Cells were transfected for 24 hours with siRNA, and cell proliferation was measured after an additional 24-hour incubation. * P < 0.05 versus control siRNA. Data represent mean ± SEM from 3 separate experiments. ( C ) Immunoblotting confirms ZNF277 overexpression in HT29 cells transfected with plasmid containing full-length human ZNF277 cDNA. ( D ) Overexpressing ZNF277 stimulates HT29 cell proliferation. * P < 0.05 versus control cells. Data represent mean ± SEM from 3 separate experiments. ( E ) Immunoblots reveal lack of ZNF277 expression in 4 HEK293 lines following CRISPR KO of ZNF277 . ( F ) CRISPR KO of ZNF277 attenuates HEK293 cell proliferation. * P < 0.05 versus control cells. ** P < 0.05 versus line 1-2. Data are shown as mean ± SD from 7 separate experiments. Data were analyzed using 2-tailed t tests and 1-way ANOVA with post hoc Tukey test. β-Actin and lamin B1 were used as loading controls in A and C , respectively.

Journal: JCI Insight

Article Title: Zinc finger protein 277 is an intestinal transit-amplifying cell marker and colon cancer oncogene

doi: 10.1172/jci.insight.150894

Figure Lengend Snippet: ( A ) ZNF277 RNA interference reduces ZNF277 protein expression in human colon cancer cells. Immunoblots of extracts from HT29, H508, and SNUC4 human colon cancer cells after ZNF277 knockdown with the indicated concentrations of ZNF277 siRNA and 50 nM mock siRNA. ( B ) ZNF277 deficiency attenuates human colon cancer cell proliferation. Cells were transfected for 24 hours with siRNA, and cell proliferation was measured after an additional 24-hour incubation. * P < 0.05 versus control siRNA. Data represent mean ± SEM from 3 separate experiments. ( C ) Immunoblotting confirms ZNF277 overexpression in HT29 cells transfected with plasmid containing full-length human ZNF277 cDNA. ( D ) Overexpressing ZNF277 stimulates HT29 cell proliferation. * P < 0.05 versus control cells. Data represent mean ± SEM from 3 separate experiments. ( E ) Immunoblots reveal lack of ZNF277 expression in 4 HEK293 lines following CRISPR KO of ZNF277 . ( F ) CRISPR KO of ZNF277 attenuates HEK293 cell proliferation. * P < 0.05 versus control cells. ** P < 0.05 versus line 1-2. Data are shown as mean ± SD from 7 separate experiments. Data were analyzed using 2-tailed t tests and 1-way ANOVA with post hoc Tukey test. β-Actin and lamin B1 were used as loading controls in A and C , respectively.

Article Snippet: We purchased 2 ZNF277 CRISPR gRNA plasmids (project name U4370DK190-1; clone C93266, gRNA TTGCAGTTTACAATGTTGTC; project name U4370DK190-2, clone C93269, gRNA AGACAGTAAGCATTGTATCC) from GenScript.

Techniques: Expressing, Western Blot, Knockdown, Transfection, Incubation, Control, Over Expression, Plasmid Preparation, CRISPR

( A ) Immunoblots of HT29 cell extracts without (control) or with CRISPR knockdown of ZNF277 expression. β-Actin was used as a loading control. ( B ) ZNF277 deficiency attenuates HT29 cell proliferation in vitro from 7 separate experiments. ( C ) ZNF277 deficiency attenuates xenograft growth. Time-course reveals reduced volume of ZNF277 CRISPR HT29 cell–derived xenografts ( n = 8) compared with control xenografts ( n = 7). ( D ) Representative images of s.c. and excised xenografts from HT29 ZNF277 CRISPR versus control cells. Arrows and arrowheads indicate control and HT29 ZNF277 CRISPR xenografts, respectively. ( E ) Reduced weights of xenografts with ZNF277 deficiency ( n = 8). * P < 0.01 versus controls ( n = 7); 2-tailed Student’s t test. ( F ) Representative microscopic images of control and ZNF277 -deficient xenografts stained for H&E, p21 WAF1 , and p53. ( G ) ZNF277, p21 WAF1 , p53, and β-catenin immunoblots of proteins extracted from ZNF277 CRISPR cell– and control cell–derived tumors (2 separate tumors from each group). Values represent mean ± SD. Scale bar: 100 μM.

Journal: JCI Insight

Article Title: Zinc finger protein 277 is an intestinal transit-amplifying cell marker and colon cancer oncogene

doi: 10.1172/jci.insight.150894

Figure Lengend Snippet: ( A ) Immunoblots of HT29 cell extracts without (control) or with CRISPR knockdown of ZNF277 expression. β-Actin was used as a loading control. ( B ) ZNF277 deficiency attenuates HT29 cell proliferation in vitro from 7 separate experiments. ( C ) ZNF277 deficiency attenuates xenograft growth. Time-course reveals reduced volume of ZNF277 CRISPR HT29 cell–derived xenografts ( n = 8) compared with control xenografts ( n = 7). ( D ) Representative images of s.c. and excised xenografts from HT29 ZNF277 CRISPR versus control cells. Arrows and arrowheads indicate control and HT29 ZNF277 CRISPR xenografts, respectively. ( E ) Reduced weights of xenografts with ZNF277 deficiency ( n = 8). * P < 0.01 versus controls ( n = 7); 2-tailed Student’s t test. ( F ) Representative microscopic images of control and ZNF277 -deficient xenografts stained for H&E, p21 WAF1 , and p53. ( G ) ZNF277, p21 WAF1 , p53, and β-catenin immunoblots of proteins extracted from ZNF277 CRISPR cell– and control cell–derived tumors (2 separate tumors from each group). Values represent mean ± SD. Scale bar: 100 μM.

Article Snippet: We purchased 2 ZNF277 CRISPR gRNA plasmids (project name U4370DK190-1; clone C93266, gRNA TTGCAGTTTACAATGTTGTC; project name U4370DK190-2, clone C93269, gRNA AGACAGTAAGCATTGTATCC) from GenScript.

Techniques: Western Blot, Control, CRISPR, Knockdown, Expressing, In Vitro, Derivative Assay, Staining

( A ) β-Catenin ( CTNNB1 ) knockdown decreases ZNF277 levels in human HT29, H508, and SNUC4 colon cancer cells. ( B ) ZNF277 knockdown does not alter β-catenin levels in HT29 and H508 colon cancer cells. Maximum siRNA concentration was 50 μM. ( C ) Increased β-catenin signaling augments Zfp277 expression. Zfp277 expression in colon mucosal extracts from WT, Apc Min/+ , and Zfp277 –/– mice. β-Actin was used as a loading control. ( D ) ZNF277 promoter elements for β-catenin. ChIP assay using random DNA fragments generated by MNase digestion in HT29 cells. ZNF277 promoter positions are indicated in the text and DNA sequences of qPCR primers are listed in . Data are shown as mean ± SEM from 3 separate experiments. ( E ) ZNF277 coimmunoprecipitates with BMI1 in SNUC4 colon cancer cells. Rabbit immunoglobulins (IgG) were used as control.

Journal: JCI Insight

Article Title: Zinc finger protein 277 is an intestinal transit-amplifying cell marker and colon cancer oncogene

doi: 10.1172/jci.insight.150894

Figure Lengend Snippet: ( A ) β-Catenin ( CTNNB1 ) knockdown decreases ZNF277 levels in human HT29, H508, and SNUC4 colon cancer cells. ( B ) ZNF277 knockdown does not alter β-catenin levels in HT29 and H508 colon cancer cells. Maximum siRNA concentration was 50 μM. ( C ) Increased β-catenin signaling augments Zfp277 expression. Zfp277 expression in colon mucosal extracts from WT, Apc Min/+ , and Zfp277 –/– mice. β-Actin was used as a loading control. ( D ) ZNF277 promoter elements for β-catenin. ChIP assay using random DNA fragments generated by MNase digestion in HT29 cells. ZNF277 promoter positions are indicated in the text and DNA sequences of qPCR primers are listed in . Data are shown as mean ± SEM from 3 separate experiments. ( E ) ZNF277 coimmunoprecipitates with BMI1 in SNUC4 colon cancer cells. Rabbit immunoglobulins (IgG) were used as control.

Article Snippet: We purchased 2 ZNF277 CRISPR gRNA plasmids (project name U4370DK190-1; clone C93266, gRNA TTGCAGTTTACAATGTTGTC; project name U4370DK190-2, clone C93269, gRNA AGACAGTAAGCATTGTATCC) from GenScript.

Techniques: Knockdown, Concentration Assay, Expressing, Control, Generated

( A ) siRNA and CRISPR knockdown of ZNF277 expression augments p21 WAF1 levels in HT29, H508, and HEK293 cells. β-Actin was used as a loading control. ( B ) Levels of murine p21 WAF1 expression are augmented in colon tissue extracts from Apc Min/+ and Zfp277 –/– mice. Experiments were performed using tissues from 2 separate 8-week-old mice of each genotype. ( C ) Upregulated p21 WAF1 expression after p53 and ZNF277 knockdown in HT29 cells. All siRNAs were 25 nM, except lane 4 (50 nM). ( D ) ZNF277 knockdown augments p21 WAF1 mRNA levels in HT29 cells. Data are shown as mean ± SEM from 3 separate experiments. * P < 0.01 (2-tailed Student’s t test). ( E ) Zfp277 deficiency stimulates cellular senescence. β-Galactosidase staining in control HT29 cells ( A ) and HT29 cells with CRISPR knockdown of ZNF277 ( B ). Scale bar: 50 μM. ( F ) Zfp277 deficiency increases p21 WAF1 expression. IHC of p21 WAF1 in the normal small intestine of WT ( A ) and Zfp277 –/– ( B ) mice, as well as in small intestine adenomas from Zfp277 +/+ Apc Min/+ ( C ) and Zfp277 –/– Apc Min/+ ( D ) mice. Arrows indicate adenomas. Scale bar: 100 μM.

Journal: JCI Insight

Article Title: Zinc finger protein 277 is an intestinal transit-amplifying cell marker and colon cancer oncogene

doi: 10.1172/jci.insight.150894

Figure Lengend Snippet: ( A ) siRNA and CRISPR knockdown of ZNF277 expression augments p21 WAF1 levels in HT29, H508, and HEK293 cells. β-Actin was used as a loading control. ( B ) Levels of murine p21 WAF1 expression are augmented in colon tissue extracts from Apc Min/+ and Zfp277 –/– mice. Experiments were performed using tissues from 2 separate 8-week-old mice of each genotype. ( C ) Upregulated p21 WAF1 expression after p53 and ZNF277 knockdown in HT29 cells. All siRNAs were 25 nM, except lane 4 (50 nM). ( D ) ZNF277 knockdown augments p21 WAF1 mRNA levels in HT29 cells. Data are shown as mean ± SEM from 3 separate experiments. * P < 0.01 (2-tailed Student’s t test). ( E ) Zfp277 deficiency stimulates cellular senescence. β-Galactosidase staining in control HT29 cells ( A ) and HT29 cells with CRISPR knockdown of ZNF277 ( B ). Scale bar: 50 μM. ( F ) Zfp277 deficiency increases p21 WAF1 expression. IHC of p21 WAF1 in the normal small intestine of WT ( A ) and Zfp277 –/– ( B ) mice, as well as in small intestine adenomas from Zfp277 +/+ Apc Min/+ ( C ) and Zfp277 –/– Apc Min/+ ( D ) mice. Arrows indicate adenomas. Scale bar: 100 μM.

Article Snippet: We purchased 2 ZNF277 CRISPR gRNA plasmids (project name U4370DK190-1; clone C93266, gRNA TTGCAGTTTACAATGTTGTC; project name U4370DK190-2, clone C93269, gRNA AGACAGTAAGCATTGTATCC) from GenScript.

Techniques: CRISPR, Knockdown, Expressing, Control, Staining

Posterior Hoxd genes are Zfp277 transcriptional targets. ( A ) Heatmap of differentially expressed genes in colon mucosa from 3 WT mice and 3 Zfp277 –/– littermates. ( B ) Top 16 upregulated genes from RNA-Seq, excluding immunoglobulins. Genes in the Hoxd cluster are highlighted in red. ( C ) Schematic of the murine Hoxd posterior gene clusters. ( D ) qPCR of Hoxd13 mRNA expression in colon mucosal tissue from WT and Zfp277 –/– mice. Values represent mean ± SEM ( n = 3 each). ( E ) ZNF277 represses HOXD13 gene expression. HOXD13 immunoblot of proteins extracted from ZNF277 CRISPR cell- and control cell–derived xenograft tumors (2 separate tumors from each group). ( F ) Model illustrating the role of ZNF 2 77/Zfp277 in intestinal tumorigenesis. ZNF277 , normally expressed in TACs but not in differentiated enterocytes, maintains intestinal homeostasis. Aberrant WNT signaling stimulates ZNF277 overexpression in TACs. ZNF277 interacts with BMI1 in the PRC1 complex and represses p21 WAF1 expression, thereby stimulating cell proliferation and attenuating cell senescence, as well as enhancing tumorigenesis and progressive neoplasia.

Journal: JCI Insight

Article Title: Zinc finger protein 277 is an intestinal transit-amplifying cell marker and colon cancer oncogene

doi: 10.1172/jci.insight.150894

Figure Lengend Snippet: Posterior Hoxd genes are Zfp277 transcriptional targets. ( A ) Heatmap of differentially expressed genes in colon mucosa from 3 WT mice and 3 Zfp277 –/– littermates. ( B ) Top 16 upregulated genes from RNA-Seq, excluding immunoglobulins. Genes in the Hoxd cluster are highlighted in red. ( C ) Schematic of the murine Hoxd posterior gene clusters. ( D ) qPCR of Hoxd13 mRNA expression in colon mucosal tissue from WT and Zfp277 –/– mice. Values represent mean ± SEM ( n = 3 each). ( E ) ZNF277 represses HOXD13 gene expression. HOXD13 immunoblot of proteins extracted from ZNF277 CRISPR cell- and control cell–derived xenograft tumors (2 separate tumors from each group). ( F ) Model illustrating the role of ZNF 2 77/Zfp277 in intestinal tumorigenesis. ZNF277 , normally expressed in TACs but not in differentiated enterocytes, maintains intestinal homeostasis. Aberrant WNT signaling stimulates ZNF277 overexpression in TACs. ZNF277 interacts with BMI1 in the PRC1 complex and represses p21 WAF1 expression, thereby stimulating cell proliferation and attenuating cell senescence, as well as enhancing tumorigenesis and progressive neoplasia.

Article Snippet: We purchased 2 ZNF277 CRISPR gRNA plasmids (project name U4370DK190-1; clone C93266, gRNA TTGCAGTTTACAATGTTGTC; project name U4370DK190-2, clone C93269, gRNA AGACAGTAAGCATTGTATCC) from GenScript.

Techniques: RNA Sequencing, Expressing, Gene Expression, Western Blot, CRISPR, Control, Derivative Assay, Over Expression